RAHMAT

Rumaisha, Sariawan atau Flu Singapur?

Posted by romansah pada November 24, 2009

Pada awalnya kami (aku dan istri) tidak begitu ‘ngeh’ dengan perilaku anak kami yang ke-3 Rumaiha yang suka menarik-narik ujung bibir atasnya. Kami pikir itu hanya iseng karena kulit bibir atas ada yang kering. Kira-kira dua hari tanggal 13 dan 14 November 2009 dia erbuat seperti itu.

Hari Minggu sore tanggal 14 November 2009 badan Rumaisha mulai terasa hangat walaupun tidak sampai panas, yang bikin kami kaget dan khawatir Rumaisha mulai tidak mau makan dan minum. Bibirnya sedikit bengkak kemerahan, ada bercak-bercak putih di bibir dalam dan gusi, serta dua bintik merah di dagu. Sariawan nih Rumaisha!

Pertama-tama kami hanya mengolesi bibir Rumaisha dengan minyak habbatusauda dan minyak zaitun, memberi sesendok madu dan sesendok sari kurma yang kami berikan rutin pada pagi hari, siang dan malam. Kami harapkan dengan memberi madu dan sari kurma badannya akan terus fit karena tidak mau makan.

Iseng-iseng browsing di internet berkaitan dengan gejala-gejala yang dialami Rumaisha ini…waduh ternyata ada kemiripan dengan wabah ‘Flu Singapur’ yang lagi ditakuti ibu-ibu di milist nih! jangan-jangan…

Hasil konsultasi sama dokter…Rumaisha hanya sariawan biasa, kebetulan anak dokter tersebut juga mengalami sakit yang sama…Alhamdulillah! Dokter hanya menyarankan dikasih candistatine, parasetamol, amoxilin, dan enervon c…semuanya dalam bentuk sirup tentunya.

Tapi kami memutuskan hanya akan mengobati Rumaisha dengan habbatusauda, minyak zaitun, madu dan sari kurma. Madu untuk penguat tubuh dan antibiotik/probiotik. Sari kurma untuk sumber energi. Minyak habbatusauda untuk meningkatkan imunitas, mengurangi alergi, anti radang dan pereda sakit. Minyak zaitun untuk mempercepat pemulihan luka. Alhamdulillah setelah dua hari berlalu Rumaisha mulai ceria bernyanyi-nyanyi, bermain dan mulai mau makan seperti jus mangga, bubur dan biskuit…Alhamdulillah sekali lagi kami beryukur atas nikmat sehat dan kemudahan yang diberikan oleh Allah SWT…sekaligus kami tambah kagum akan khasiat habbatusauda, zaitun, dan madu.

Iklan

Posted in Kesehatan Umum | Dengan kaitkata: , , , | Leave a Comment »

Flu Singapura

Posted by romansah pada November 23, 2009

FLU SINGAPURA – HFMD – KTM

“Flu Singapura” sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )
Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.

EPIDEMIOLOGI:
Penyakit ini sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum/”biasa” pada kelompok masyarakat yang “crowded” dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (“carrier”) seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.

GAMBARAN KLINIK :
Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti “flu” pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.
Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini membaik sendiri dalam 7-10 hari.
Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Pada bayi/anak-anak muda yang timbul gejala berat , harus dirujuk kerumah sakit sebagai berikut :

o Hiperpireksia ( suhu lebih dari 39 der. C).
o Demam tidak turun-turun (?Prolonged Fever?)
o Tachicardia.
o Tachypneu
o Malas makan, muntah atau diare dengan dehidrasi.
o Lethargi
o Nyeri pada leher,lengan dan kaki.
o Serta kejang-kejang.

Komplikasi penyakit ini adalah :

o Meningitis (aseptic meningitis, meningitis serosa/non bakterial)
o Encephalitis ( bulbar )
o Myocarditis (Coxsackie Virus Carditis) atau pericarditis
o Paralisis akut flaksid (“Polio-like illness” )

Satu kelompok dengan penyakit ini adalah :

1. Vesicular stomatitis dengan exanthem (KTM) – Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) – EV 70
3. Acute Lymphonodular Pharyngitis – Cox A 10

LABORATORIUM :
Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan “Hank’s Virus Transport”. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.
Setelah dilakukan “Tissue Culture”, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.
Diagnosa Laboratorium adalah sebagai berikut :
1. Deteksi Virus :
o Immuno histochemistry (in situ)
o Imunofluoresensi antibodi (indirek)
o Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.
2. Deteksi RNA :
RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)
3. Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

TATALAKSANA :
o Istirahat yang cukup
o Pengobatan spesifik tidak ada.
o Dapat diberikan :
Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus

Extracorporeal membrane oxygenation.

o Pengobatan simptomatik :
Antiseptik didaerah mulut Analgesik misal parasetamol Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah “self limiting diseases” ( berobat jalan ) yang sembuh dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.

PENCEGAHAN DAN PENGENDALIAN PENYAKIT:

Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan “Overcrowding”, kebersihan (Higiene dan Sanitasi). Lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit “Universal Precaution” harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)

UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan KTM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tamda-tanda dan gejala KTM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
o Daya tahan tubuh menurun.
o Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana KTM termasuk pelaksanaan “Universal Precaution”nya.

Hand-Foot-Mouth Disease (HFMD)
Etiologi : Coxsackievirus A 16
Cara Penularan : Droplets
Masa Inkubasi : 4 – 6 Hari

Manifestasi Klinis :
Masa prodromal ditandai dengan panas subfebris, anoreksia, malaise dan nyeri tenggorokan yang timbul 1 – 2 hari sebelum timbul enantem. Enantem adalah manifestasi yang paling sering pada HFMD. Lesi dimulai dengan vesikel yang cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki, pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong. Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadibula dan biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi menghilang tanpa bekas.

Diagnosis :
Manifestasi klinis dan isolasi virus dengan preparat Tzank.
Diagnosis Banding : Varisela, herpes
Terapi : Simptomatis

Sumber : infeksi.com

Posted in Kesehatan Umum | Dengan kaitkata: | Leave a Comment »

Sariawan

Posted by romansah pada November 23, 2009

KOMPAS.com – Sariawan merupakan suatu kelainan pada selaput lendir mulut, yang ditandai adanya bercak luka berwarna putih pada dinding mulut atau bibir. Meski kecil dan letaknya tersembunyi di rongga mulut namun sariawan bisa menimbulkan rasa nyeri hebat.

Menurut drg. Ratu Mirah Afifah, GCCLindent, MDSc, staf pengajar Fakultas Kedokteran Gigi Universitas Padjajaran, Bandung, di dalam rongga mulut banyak terdapat bakteri dan jamur yang bisa menyebabkan sariawan.

Sariawan juga bisa disebabkan karena gangguan keseimbangan tubuh akibat stres, kurang vitamin C, kurang tidur. Faktor lain yang menyebabkan sariawan antara lain kesalahan menggosok gigi, apalagi jika menggosoknya serampangan dan tak hati-hati. Luka di seputar mulut akibat tergigit atau terjatuh juga bisa menyebabkan infeksi dalam bentuk sariawan.

“Pemakaian gigi palsu atau kawat gigi yang tidak pas juga akan membuat jaringan lunak teriritasi sehingga timbul sariawan,” papar Ratu. Sebatang rokok juga bisa merusak vitamin C yang ada dalam tubuh, akibatnya seorang perokok lebih mudah terkena sariawan.

Sariawan yang disebabkan oleh faktor lokal infeksi biasanya akan sembuh dalam waktu dua minggu. Akan tetapi, bila luka mirip sariawan tetap menetap hingga berbulan-bulan, bisa jadi itu merupakan tanda penyakit serius, seperti HIV/AIDS atau kanker mulut. “Penyakit gangguan kekebalan tubuh seperti HIV bisa menyebabkan tubuh mudah terserang infeksi, terutama luka dalam mulut,” kata Ratu.

Karena itu bila Anda mengidap penyakit sariawan yang tak kunjung sembuh, segeralah berkonsultasi ke dokter untuk melakukan pemeriksaan lebih lanjut.

Ada beberapa cara yang bisa mencegah sariawan, misalnya makan dengan tenang agar bibir atau lidah tidak tergigit. Luka di kedua tempat itu lambat penyembuhannya sehingga mudah terkena infeksi bakteri atau kuman di mulut. Pastikan gigi dan mulut selalu terawat, berkumurlah dengan antiseptik jika ada gangguan sariawan, serta hindari stres.

Perbanyak pula sayuran dan buah-buahan karena banyak mengandung vitamin C, B2, B5, dan asam folat yang sangat bermanfaat mencegah sariawan.

Posted in Kesehatan Umum | Dengan kaitkata: | Leave a Comment »

Petunjuk Rosulullah SAW dalam Olahraga (2)

Posted by romansah pada Juli 29, 2009

Sumber : Ath-Thib An-Nabawi, Ibnu Qoyim Al-Jauziyah

Sementara itu olahraga batin dilakukan melalui belajar dan mempelajari adab, dengan bergembira dan bersukaria, bersabar, bersikap teguh, bersikap berani, mudah memaafkan, berbuat kebajikan dan sejenisnya yang bisa mengolah batin. Olahraga batin terbaik adalah bersabar, memupuk cinta kasih, bersikap berani dan suka berbuat baik. Orang yang melakukan olahraga batin ini sedikit demi sedikit pasti seluruh sifat tersebut betul-betul mengakar dalam dirinya dan menjadi tabiat yang kuat sekali.

Kalau kita mencermati petunuk Nabi SAW dalam hal ini, kita akan mendapatkan petunjuk beliau itu sebagai penjagaan optimal terhadap kesehatan dan stamina, amat berguna dalam kehidupan di dunia dan di akhirat.

Tidak diragukan lagi bahwa shalat saja mengandung cara menjaga kesehatan tubuh. Shalat mengandung komposisi gerak yang terbaik buat dirinya di samping hal-hal lain untuk menjaga kesehatan iman dan kebahagiaan dunia dan akhirat. Demikian juga dengan shalat malam. Shalat malam merupakan cara terbaik menjaga kesehatan dan cara terbaik untuk menolak berbagai penyakit menahun selain juga menjadi cara meningkatkan semangat jiwa dan raga serta hati seseorang. Seperti disebutkan dalam shahih Al-Bukhari dan Muslim dari Rasulullah SAW bahwa beliau bersabda :

“Setan mengikatkan tiga buhul ikatan di kepala manusia bila ia tidur. Pada masing-masing buhulan itu setan memberi pukulan sambil berkata: ‘Nikamatilah malam yang panjang, tidurlah’. Kalau ia bangun lalu berdzikir kepada Allah, terbukalah satu ikatan. Bila ia berwudhu, terbukalah ikatan kedua. Dan bila ia sudah shalat, terbukalah seluruh ikatan sehingga ia berubah menjadi orang yang bersemangat jiwanya. Kalau tidak, ia akan berubah menjadi orang yang malas dan busuk jiwanya.”

Puasa yang disyariatkan juga termasuk di antara faktor penjaga kesehatan, sebagai olahraga bagi tubuh dan jiwa seseorang. Itu hal yang tidak dapat dipungkiri oleh orang yang sehat fitrahnya.

Adapun jihad dengan segala totalitas gerak tubuh yang terkandung di dalamnya termasuk diantara faktor terbaik dalam membina stamina, menjaga kesehatan, memperkuat jantung dan tubuh serta mengusir berbagai ampas makanan yang tidak berguna, bahkan juga menghilangkan kesedihan, kegundahan dan duka lara. Semua itu adalah hal yang hanya diketahui oleh orang yang memiliki peran dalam jihad itu sendiri. Demikian juga halnya dengan haji dengan berbagai manasik hajinya, juga perlombaan kuda dan lomba senjata, melakukan perjalanan untuk suatu keperluan atau untuk menemui saudara, memenuhi keperluan mereka, menjenguk orang sakit, mengiringi jenajah mereka, berjalan menuju masjid untuk melaksanakan shalat jumat dan shalat jama’ah, melakukan beberapa gerakan saat berwudhu, mandi jinabat dan lain-lain.

Demikian , semua bentuk ibadah tersebut setidaknya merupakan olahraga batin dalam menjaga kesehatan dan mengusir ampas tidak berguna. Adapun kandungan lain berupa cara untuk mendapatkan kebaikan dunia dan akhirat serta menolak berbagai kejelekan dunia dan akhirat, maka itu adalah perkara lain lagi.

Dengan demikian pula kita mengetahui bahwa petunjuk Rasulullah SAW itu berada di atas segala petunjuk, dalam upaya merawat kondisi tubuh dan hati, memelihara kesehatan keduanya serta menolak berbagai penyakit. Tidak ada hal lain yang perlu dijelaskan lagi lebih dari itu bagi orang yang memiliki pemahaman yang sehat. Semoga Allah memberikan taufik-Nya.

Posted in Kesehatan Umum | Dengan kaitkata: , | Leave a Comment »

Petunjuk Rasulullah SAW dalam Olahraga (1)

Posted by romansah pada Mei 14, 2009

Sumber : Ath-Thib An-Nabawi, Ibnu Qoyim Al-Jauziyah

Suatu hal yang dimaklumi bahwa tubuh seseorang untuk bisa bertahan hidup memerlukan makanan dan minuman.  Makanan memang tidak seluruhnya akan menjadi bagian dari tubuh.  Setiap proses pencernaan masih akan menghasilkan ampas yang apabila terlalu banyak dalam waktu yang lama akan menumpuk dalam jumlah banyak pula.  Saat itu dengan kuantitas yang banyak dan kualitas yang berat, ampas tersebut akan berbahaya, bisa menyebabkan penyumbatan atau menyebabkan kegemukan,  selain juga bisa menyebabkan beberapa penyakit dalam.  Kalau dipompa keluar, obat-obatan pencahar seringkali mengganggu kesehatan.  Karena kebanyakan adalah racun.  Proses pemompaan keluar sendiri seringkali mengeluarkan juga zat-zat makanan yang masih bermanfaat.  Sementara proses pengendapan ampas itu sendiri dapat memanaskan tubuh sehingga menyebabkan zat-zat basi ikut terpanaskan, atau mendinginkan tubah sehingga memperlemah suhu panas alami dan menghambat proses pembakaran.

Ampas-ampas tersebut tidak diragukan lagi amatlah berbahaya bila dibiarkan dalam tubuh dan sama bahayanya bila dipaksa keluar.  Olahraga adalah cara terbaik untuk mencegah lahirnya ampas makanan tersebut.  Karena olahraga dapat memanaskan tubuh, mencairkan sisa ampas sehingga tidak mendekam terlalu lama.  Di samping itu olahraga juga dapat membiasakan tubuh bergerak lincah dan penuh semangat, menambah nafsu makan, mengeraskan persendian, memperkuat otot dan urat, bahkan menyelamatkan diri seseorang dari berbagai akibat zat kimia juga kebanyakan penyakit pencernaan, bila digunakan secara proporsional dan pada waktu yang tepat dan tentunya dengan sistem yang tepat pula.

Waktu olahraga yang terbaik adalah setelah selesai proses pencernaan makanan.  Olahraga yang proporsional adalah bila sampai menyebabkan warna kemerahan pada kulit, nafas memburu dan badan terasa segar.  Kalau harus mengeluarkan keringat, itu terlalu berlebihan.  Bagian tubuh manapun yang dilatih dengan olahraga yang baik akan menjadi kuat, terutama sekali bila disesuaikan dengan jenis olahraga yang tepat.  Bahkan setiap bentuk energi dilatih dengan cara yang sama.  Orang yang banyak menghapal akan kuat daya hapalnya.  Orang yang sering berpikir akan kuat daya pikirnya.  Masing-masing anggota badan memiliki olahraga spesifik yang sesuai dengannya.  Olahraga otak adalah membaca.   Dimulai dengan membaca perlahan hingga keras-keras secara bertahap.  Olahraga pendengaran adalah dengan mendengarkan bicara juga secara bertahap, dari mulai pembicaraan ringan hingga yang berat-berat.  Demikian juga olahraga lidah, dilakukan dengan berbicara.  Olahraga mata juga dilakukan dengan melihat.  Olahraga kaki (berjalan) juga dilakukan secara bertahap, sedikit demi sedikit.

Adapun menunggang kuda, melempar lembing, gulat, lomba lari, kesemuanya adalah olahraga fisik.  Semua jenis olahraga itu dapat menghilangkan berbagai bentuk penyakit menahun, seperti lepra, busung lapar dan sembelit.

Posted in Kesehatan Umum | Dengan kaitkata: , | Leave a Comment »

Mengatur Kehamilan dengan KB Alami

Posted by romansah pada Maret 12, 2009

Ada berbagai pendapat yang mengatakan bahwa penggunaan obat KB (Keluarga Berencana) dapat menimbulkan berbagai efek, mulai dari rasa kurang nyaman, berkurangnya gairah, bahkan beberapa wanita yang tingakat toleransi tubuhnya sangat rendah terhadap efek samping alat kontrasepsi yang dipakainya bisa mengalami keluhan-keluhan seperti mual, pusing, maslaah kulit, obesitas, perdarahan, nyeri perut, hingga risiko hamil anggur pada obat KB jenis spiral.

Apa tujuan perempuan menggunakan obat KB? Jawaban yang palling tepat adalah untuk mengontrol jumlah dan jarak antara kelahiran anak. Bagi perempuan yang ingin menghindari efek samping alat kotrasepsi, mereka lebih memilih KB alami. KB alami yang lama antara lain dengan sistem kalender yaitu mengetahui siklus haid dan masa suburnya.

Bagaimana menghitung masa subur? Menurut Dr. Sugi Suhandi Iskandar, SpOG dari RS Mitra Kemayoran, Jakarta, yang disebut dengan masa subur adalah masa dimana terjadinya ovulasi pada pertengahan siklus haid. Ovulasi mengaluarkan sel telur yang sudah matang dan siap dibuahi oleh sperma. Pembuahan inilah yang akan tumbuh menjadi janin.

Pada pasangan suami-istri yang melakukan KB kalender, sebaiknya harus mempunyai menogram, yaitu catatan menstruasi istri selama setahun.

Untuk mengetahui masa subur, pertama, tentukan panjang siklus menstruasi anda. Hitung sejak hari pertama haid hingga tepat satu hari sebelum haid pada bulan berikutnya.

Kedua, sesuai dengan siklus menstruasi Anda, hitung dan temukan perkiraan hari pertama haid untuk bulan selanjutnya, kemudian dikurangi 14 hari. Karena masa subur terjadi 14 hari sebelum haid pertama pada bulan berikutnya.

Jika siklus haid tidak teratur, salah satu caranya dapat dengan menghitung rata-rata panjang siklus haid 3 bulan. Sesuai dengan siklus menstruasi Anda. Hitung dan tentukan perkiraan hari pertama haid untuk bulan selanjutnya. Kemudian dikurangi 14 hari. Jika ingin menunda kehamilan, sebaiknya tidak melakukan hubungan atau memakai alat kontrasepsi berupa kondom di antara range masa subur (1 hingga 6 hari) tersebut.

Menghitung masa subur dengan menghitung siklus haid agak susah dilakukan (kurang akurat) jika siklus haid tidak teratur atau sedang menggunakan obat-obat tertentu yang bisa mempengaruhi siklus hair, misalnya sedang melakukan pengobatan hormon, mengalami stress berat/penyakit kronis yang bisa mengubah pola haid, atau terjadi trauma mengenai alat-alat kandungan sehingga terjadi gangguan fungsi (jarang terjadi).

Untuk membantu mengetahui masa subur, Anda dapat menggunakan Fertitest. Fertitest adalah alat uji masa subur pada perempuan dengan mengukur kadar LH (Lutenizing Hormone) pada urine. Fertietest bekerja dengan cara bereaksi (berubah warna atau memeunculkan tanda) satu hari sebelum masa subur karena kenaikan LH yang diproduksi oleh kelenjar pitutary sudah terjadi. Yang perlu diantisipasi dan diingat adalah kemampuan sperma dapat bertahan hidup selama 3-5 hari atau lebih lama dalam serviks perempuan bila ada lendir serviks yang subur. [OCH]

Sumber : KOMPAS, 12 Maret 2009

Posted in Kesehatan Umum | Dengan kaitkata: , , | Leave a Comment »

Mengenal Sistem Pencernaan

Posted by romansah pada Februari 27, 2009

Dalam sebuah hadits, Rasulullah saw bersabda :

“Tidaklah anak adam mengisi bejana yang lebih buruk daripada perutnya. Cukuplah bagi mereka beberapa suap yang dapat menegakkan tulang sulbinya. Kalaulah dia harus berbuat, maka sepertiga untuk mekanannya, sepertiga lagi untuk minumannya dan sepertiga lagi untuk nafasnya.” (H.R At-Tirmidzy dan Ahmad).

Perut memang merupakan sumber sebagian besar penyakit. Tetapi, hingga saat ini belum ada kesepakatan tentang pengertian ‘perut’ sebagaimana dimaksud dalam hadits Rasulullah saw tersebut. Sebagian orang (termasuk para ahli medis) berpendapat bahwa yang dimaksud ‘perut’ dalam hadits tersebut adalah sistem pencernaan (digestive system). Hal ini mengingat makanan yang dimakan manusia masuk ke dalam tubuh melewati sistem pencernaan.

Sedangkan dalam pandangan herbalis (khususnya para praktisi perubatan JAWI) yang dimaksud dengan ‘perut’ sebagaimana disebutkan dalam hadits tersebut lebih mengarah pada kolon (usus besar). Sebab pada organ ini sering terjadi penumpukan sisa-sisa makanan yang pada akhirnya bisa menjadi pemicu munculnya berbagai penyakit.

Atau yang dimaksud dengan ‘perut’ disini sebagaimana lebih dikenal secara umum oleh kita adalah lambung. Lambung atau ventrikulus berupa suatu kantong yang terletak di bawah sekat rongga badan. Lambung dapat dibagi menjadi tiga daerah, yaitu daerah kardia, fundus dan pilorus. Kardia adalah bagian atas, daerah pintu masuk makanan dari kerongkongan . Fundus adalah bagian tengah, bentuknya membulat. Pilorus adalah bagianbawah, daerah yang berhubungan dengan usus 12 jari (duodenum).

Posted in Mengenal Sistem Pencernaan | Dengan kaitkata: , , , , | Leave a Comment »

Proses Pencernaan Makanan

Posted by romansah pada Februari 26, 2009

Manusia memerlukan makanan untuk menjaga kelangsungan hidupnya. Makanan dapat menghasilkan energi sebagai bahan pembentuk tubuh, penambah cairan tubuh dan membantu proses faal lain yang berlangsung dalam tubuh. Hanya saja makanan baru bisa bermanfaat bila zat-zat yang dikandungnya dapat diserap oleh usus. Artinya makanan tersebut harus dicerba terlebih dahulu.

Pada tubuh manusia telah terdapat sistem pencernaan makanan (digestive system) yang kompleks. Selama dalam proses pencernaan, makanan dihancurkan menjadi zat-zat sederhana sehingga dapat diserap oleh usus, kemudian digunakan oleh sel jaringan tubuh. Berbagai jenis enzim turut membantu dalam proses pencernaan ini. Selanjutnya agar makanan dapat berguna bagi tubuh, maka makanan tersebut harus didistribusikan oleh darah sampai pada sel-sel diseluruh tubuh.

Rasulullah saw menganjurkan kepada kita agar mengunyah makanan sekurang-kurangnya 33 kali. Hal ini dimaksudkan agar makanan tersebut menjadi sehalus mungkin untuk selanjutnya dicerna secara kimiawi oleh enzim-enzim pencernaan.

Mengutif penjelasan Ibu Andang Gunawan (FoodCombining.com) bahwasanya berdasarkan penelitian ekstensif tentang siklus fisiologi, ditemukan bahwa setiap fungsi tubuh memiliki irama aktivitas biologi yang bekerja secara sistematis dalam siklus atau putaran 24 jam tanpa henti. Proses pencernaan sendiri terdiri dari tiga siklus yang didasarkan pada tiga fungsi tubuh, yaitu menyerap (sari-sari makanan), mencerna (zat-zat makanan), dan membuang (sampah-sampah makanan). Meskipun ketiga fungsi tersebut bekerja aktif secara simultan (terus-menerus), setiap delapan jam sehari masing-masing lebih intensif dibandingkan siklus-siklus lainnya.

Pukul 12.00 – 20.00       : PENCERNAAN
Pukul 20.00 – 04.00       : PENYERAPAN
Pukul 04.00 – 12.00       : PEMBUANGAN

Siklus pencernaan sangat intensif antara pukul 12.00 (tengah hari) dan pukul 20.00 (8 malam). Pada siklus ini energi tubuh lebih banyak dipusatkan ke fungsi pencernaan. Sepanjang siklus ini merupakan saat yang tepat untuk mengisi lambung dengan makanan padat. Kalau pada siang hari perut tak terisi, Anda akan merasa sangat lapar.

Siklus penyerapan berlangsung sangat intensif antara pukul 20.00 (8 malam) dan pukul 04.00 (dini hari). Sepanjang siklus ini terjadi proses penyerapan sebagian besar zat-zat makanan yang sudah tercerna dan pembagian zat-zat makanan ke seluruh bagian tubuh. Karena itu, tidur terlambat atau makan larut malam dapat mengurangi pasokan energi yang diperlukan untuk proses penyerapan. Hambatan pada salah satu siklus dapat mengacaukan siklus-siklus berikutnya, sehingga Anda akan merasa grogi pada pagi harinya.

Siklus pembuangan sangat intensif terjadi antara pukul 04.00 (tengah hari) dan pukul 12.00 (tengah hari). Pada siklus ini, energi akan lebih banyak dipakai untuk membantu proses pembuangan. Sampah akan lebih banyak dikeluarkan dalam siklus ini. Banyak orang mengeluh tidak mempunyai nafsu makan pada pagi hari, tapi tidak menyadari bahwa ini adalah hal sangat alami. Karena tubuh tengah melalui siklus pembuangan. Tubuh tidak terlalu membutuhkan makanan padat (misalnya nasi dan daging) yang sulit dicerna dalam kurun waktu tersebut, malah bisa mengacaukan proses pembuangan karena kekurangan energi.

Posted in Mengenal Sistem Pencernaan | Dengan kaitkata: , , | Leave a Comment »

Gangguan Pada Sisem Pencernaan

Posted by romansah pada Februari 25, 2009

Sistem pencernaan bisa mengalami gangguan, baik gangguan terhadap kelenjar pencernaan maupun saluran pencernaannya sendiri. Apabila kelenjar pencernaan mengalami gangguan maka dapat mengenai enzim-enzimnya sehingga dapat mengganggu proses pencernaan secara keseluruhan.

Gangguan pencernaan dapat berupa radang atau infeksi. Radang tersebut dapat mengenai mulut, lambung, usus kecil dan usus besar, serta umbai cacing (apendiks). Radang juga dapat mengenai kelenjar pencernaan seperti radang pada kelenjar parotis (parotitis) dan radang pada hati atau biasa dikenal dengan hepatitis. Radang pada dinding lambung dapat menyebabkan tukak lambung yaitu luka pada lapisan mukosa dinding lambung. Radang pada usus buntu disebut dengan apendisitis. Radang pada usus halus sering dijumpai kerena infeksi pada penyakit tifus yang menyebabkan demam tinggi. Radang pada usus besar yang sring disebabkan oleh bakteri atau amoeba dapat menyebabkan disentri atau kolera yang menimbulkan gejala diare.

Pada anak-anak yang sering dijumpai adalah adanya cacing yang menhuni dalam usus halus maupun usus besar dan bersifat parasit. Misalnya cacing gelang, cacing tambang dan cacing kremi. Selain itu masih banyak lagi penyakit yang terjadi akibat adanya gangguan pada sistem pencernaan seperti kolitis (peradangan pada kolon), kejang usus, kanker dan lain-lain.

Posted in Mengenal Sistem Pencernaan | Dengan kaitkata: , , | Leave a Comment »

Penyebab Gangguan Sistem Pencernaan

Posted by romansah pada Februari 24, 2009

Gangguan pada sistem pencernaan umumnya disebabkan oleh kebiasaan cara makan yang salah.  Beberapa hal yang dapat menyebabkan gangguan tersebut antara lain :

  1. Makan tidak teratur,  seperti makan terlalu banyak (hingga kekenyangan) atau terlalu sering makan.  Rasulullah mengajarkan agar mengisi perut dengan sepertiga makanan, sepertiga air dan sepertiga udara.
  2. Makan sambil diselingi minum air.  Hal ini dapat mencairkan rembesan di perut.
  3. Kebiasaan makan yang terlalu cepat.  Dengan cara seperti ini biasanya proses pengunyahan makanan kurang optimal, makanan dikunyah hanya beberapa kali saja.  Akibatnya proses pencernaan menjadi tidak sempurna.
  4. Tekanan perasaan dan faktor umur.  Pada saat stress tubuh akan mengaluarkan hormon yang mengandung bahan kimia tertentu yang bersifat racun.  Hormon ini akan mempengaruhi rekasi kimia tubuh sehingga proses pencernaan terganggu.  Sedagkan orang yang sudah tua, biasanya organ pencernaannya tidak lagi dapat berfungsi secara optimal.

Sistem pencernaan yang terganggu biasanya ditandai dengan munculnya gejala-gejala antara lain :

  • Badan atau nafas berbau
  • Lambat dalam mencerna makanan
  • Rambut menjadi kering atau rusak
  • Sering buang angin setelah makan
  • Kurang selera makan atau kurang tenaga
  • Kuku rusak dan mudah patah
  • Buang air besar tidak lancar
  • Mengalami gangguan dan kelainan masalah kulit
  • Tulang dan gigi rawan lemah

Posted in Mengenal Sistem Pencernaan | Dengan kaitkata: | 1 Comment »